Chương 5.1 Các công cụ: Sử dụng hoá sinh và đánh dấu phân tử

?Các yếu tốmôi trườngcó thể làm ảnh hưởng đến các đặc điểm về hình thái ?Đánh dấu phân tử tập trung vào vật liệu di truyền hoặc các biến dị được kiểm tra bởi các gen ?Đánh dấu phân tử đươc sử dụng cho ? Đo đếm vài chỉ số của đa dạng di truyền ? Bản đồ gen ? Chọn các vật liệu di truyền cho các chương trình chọn giống

pdf67 trang | Chia sẻ: lylyngoc | Lượt xem: 1772 | Lượt tải: 1download
Bạn đang xem trước 20 trang tài liệu Chương 5.1 Các công cụ: Sử dụng hoá sinh và đánh dấu phân tử, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
CÁC CÔNG CỤ: Sử dụng hoá sinh và đánh dấu phân tử Chương 5.1 ƒ Các yếu tố môi trường có thể làm ảnh hưởng đến các đặc điểm về hình thái ƒ Đánh dấu phân tử tập trung vào vật liệu di truyền hoặc các biến dị được kiểm tra bởi các gen ƒ Đánh dấu phân tử đươc sử dụng cho ƒ Đo đếm vài chỉ số của đa dạng di truyền ƒ Bản đồ gen ƒ Chọn các vật liệu di truyền cho các chương trình chọn giống Giới thiệu ƒ Đánh dấu phân tử ƒ Chuỗi DNA dễ phát hiện và một protein thừa kế có thể giám sát ƒ Hiện tượng đa hình trong protein ƒ Giống chứa các protein ƒ Isozyme và allozyme ƒ Hiện tượng đa hình trong DNA ƒ Nhân ƒ Tế bào chất (Chloroplast DNA và Mitochondrial DNA) Đánh dấu phân tử là gì ? Sử dụng đánh dấu phân tử để đo đếm biến dị di truyền ƒ Đánh dấu dựa vào protein ƒ Cơ sở DNA ƒ Đánh dấu dựa vào RFLP ƒ PCR ƒ RAPD ƒ Ghi vị trí các chuỗi ƒ AFLP ƒ Các kỹ thuật điện di ƒ Giới thiệu protein ƒ Giống chứa các protein ƒ Isozyme và allozyme Đánh dấu dựa trên protein Cấu trúc cơ bản của protein ƒ Tại sao sử dụng protein chứa trong hạt giống ? ƒ Hạt giống là nguồn chứa protein phong phú ƒ Protein có sẳn về số lượng ƒ Hạt giống dễ xác định được các giai đoạn phát triển ƒ Phương pháp ƒ Trích protein (pH, acid) ƒ Tách protein riêng lẽ theo phương pháp điện di (Polyacrynamide gel electrophoresis) ƒ Có thể nhìn thấy protein trên gel bằng cách nhuộm màu (Coomassie blue, Imido black) ƒ Phân tích các kiểu dãi Giống chứa các protein ƒ Nhiều hình dạng của enzyme giống nhau ƒAllozyme: Một enzyme, một gen locus ƒ Isozyme: Một enzyme, nhiều hơn một gen locus ƒ Phương pháp ƒNgâm các mô trong môi trường đệm lạnh ƒTách protein riêng lẽ theo pp điện di ƒĐịnh vị enzyme bằng nhuộm mô hoá học ƒ Phân tích các kiểu dãi Isozyme và allozyme ƒ Đồng hợp tử hay dị hợp tử ƒ Cấu trúc thứ tư của enzyme ƒ Số lượng gen loci ƒ Số nhiễm sắc thể ƒ Phân tích di truyền đôi khi cần thiết Phân tích các band Ví dụ Đáùnh dấáu trên cơ sơâ ûû DNA DNA cơ bản Tổng hợp DNA Tổ chức của DNA ƒ Đa hình các đoạn cắt (Restriction Fragment Length Polymorphism – RFLP) gồm các bước: ƒ Tách cô lập DNA ƒ Dùng các enzyme giới hạn để cắt thành các đoạn nhỏ ƒ Tách các đoạn cắt của DNA bằng gel điện di ƒ Chuyển các DNA cắt qua bộ lọc ƒ Dùng các cực dò nhản phóng xạ để đọc DNA ƒ Phân tích kết quả Đánh dấu dựa vào RFLP Tách các đoạn cắt của DNA bằng gel điện di Chuyểån cáùc DNA cắét qua bộä lọïc RFLP Ví dụ: RFLP của Brassica Phân tích kết quả (single-Locus probes) Phân tích kết quả (Multi-Locus probes) ƒ Kỹ thuật trong sinh học phân tử mà một đoạn DNA nhỏ có thể nhân thành nhiều bản. ƒ Polymerase Chain Reaction (PCR) sử dụng một enzyme được biết đến như là polymerase để nhanh chóng nhân lên từ một đoạn DNA nhỏ mà mang các đặc điểm di truyền của sinh vật. ƒ Mỗi chu kỳ PCR gồm có 3 pha: ƒ Pha 1: Làm biến tính của DNA thông qua nhiệt để các sợi tách ra ƒ Pha 2: Nhiệt độ của hỗn hợp được hạ thấp để cho các miếng Primer gắn vào với các DNA đã tách ra ƒ Pha 3: Sự trùng hợp . Nhiệt độ nóng lên để polymerase enzyme sao chép nhanh DNA. ƒ Mỗi chu kỳ PCR nhân đôi số lượng DNA, khoảng 1 tỉ bản sao của 1 đoạn DNA có thể tạo nên trong vài giờ ƒ PCR được dùng để xác định một cá nhân nào đó từ một ít mô hoặc máu, để chẩn đoán bệnh di truyền và nghiên cứu tiến hoá Phản ứng chuỗi polymera Polymerase Chain Reaction (PCR) PCR 94-960C 50-650C 720C Chu kỳ lập lại từ 25 – 50 lần ƒ Enzyme giới hạn (restriction enzymes) có trong vi khuẩn có nhiệm vụ như chiếc kéo phân tử để cắt các cột Phosphat của phân tử DNA ở các chuỗi bazơ cụ thể. ƒ Chuỗi DNA bị cắt với các enzyme giới hạn để lại 1 đuôi được gọi là điểm dính tận cùng (sticky ends) do nó có thể nối lại với các đuôi khác của các mảnh vỡ của DNA nào đó. ƒ Các nhà khoa học lợi dụng các enzyme giới hạn và điểm dính được tạo ra bởi enzyme để thực hiện việc tái tổ hợp kỹ thuật DNA Tái tổ hợp DNA (Recombinant DNA) Polymerase Chain Reaction (PCR) VCD: DNA Structure and Replication ƒ Kỹ thuật PCR và tái tổ hợp DNA tạo nên nhiều đoãn DNA. Để nghiên cứu cấu trúc của các đoạn này người ta dùng phương pháp điện di gel ƒ Trong điện di gel, các restriction enzymes tách các DNA nghiên cứu thành những đoạn có chiều dài khác nhau. Các dung dịch chứa nhựng đoạn này được đặt trong chất gel dày và cho dòng điện chạy qua, một đầu là âm một đầu là dương. Tất cả các đoạn hạn chế bắt đầu di chuyển từ cực âm sang cực dương. Những đoạn nhỏ hơn di chuyển nhanh hơn những đoạn lớn hơn.Sau vài giờ ngắt dòng điện thì các đoạn DNA trãi suốt xuyên qua chất gel, các đoạn nhỏ hơn thì gần phía cực dương. Sự phân tán các đoạn trình bày 1 kiểu tương tự với sọc mã số. Mỗi sọc trong kiểu này chứa các đoạn DNA của 1 kích thước nào đó. Người ta xác định các đoạn giới hạn cụ thể bằng các vị trí của nó trên gel. ƒ Một chuổi DNA bổ sung có thể được dùng thăm dò để tìm kiếm một đoạn giới hạn trong gel mà có chuỗi nucleotid có liên quan. ƒ Các nhà khoa học dùng các DNA thấy được trong máu để so sánh DNA trong điện di gel để so sánh bằng chứng của tội phạm Điện di gel (Gel electrophoresis) Ưùng dụng đánh dấu phân tử trong lâm nghiệp Đánh dấu phân tử (Molecular markers) ƒ Đánh dấu phân tử là các công cụ di truyền cho phép chúng ta nghiên cứu sự khác nhau giữa các cá thể ở nhiều vị trí trong không gian thông qua bộ gen. Đánh dấu được sử dụng để ghi đại chỉ các gen kiểm soát các tính trạng. Nhận biết vị trí của các gen rồi cho phép tách và mô tả theo quy luật tự nhiên. Các dấu này cũng cho các ý tưởng để kiểm tra nghiên cứu các mối quan hệ trong giữa các cá thể, các quần thể và phân loại phát sinh loài. ƒ Đánh dấu phân tử thường sử dụng trong lâm nghiệp là: ƒ Điện di protein (Protein electrophoresis - Isozymes) ƒ Đa hình độ dài các đoạn cắt (restriction fragment length polymorphism – RFLP) ƒ Vi vệ tinh (Simple sequence repeats - SSR or microsatellites), ƒ Đa hình DNA nhân bản ngẫu nhiên (Random amplified polymorphic DNA - RAPD), ƒ Đa hình chiều dài các đoạn DNA được nhân bản (amplified fragment length polymorphism - AFLP) ƒ Theo Daniel Plat, 2004 Mô hâ ình tính trạïng di truyềàn sốá lượïng củûa 1 locus Các ảnh hưởng trung bình của các Allen A1 và A2 THÊM VÀO Các ảnh hưởng tương tác giữa Allen A1 và A2 ƯU THẾ Theo Daniel Plat, 2004 Tương tác trong các loci Tính gen trội Mô hâ ình tính trạïng di truyềàn sốá lượïng củûa 2 loci ương tá o g các loci Theo Daniel Plat, 2004 Trong các loài cây, các bản đồ liên kết rất thường được sử dụng để xác định các vùng nhiễm sắc thể một cách cụ thể mà kiểm tra tính trạng có giá trị kinh tế quan trọng như tình kháng bệnh, tỉ trọng gỗ hay sinh trưởng. Các tính trạng biến động theo số lượng trong mỗi loài cây và các vùng được xác định được gọi là vị trí tính trạng số lượng (QTC). Phân tâ ích cáùc locus tính trạïng sốá lượïng (QTL Analysis) ƒ Xây dựng bản đồ gen là một công cụ mạnh và mới trong nghiên cứu di truyền không những cho con người nhưng cũng cho cây nông nghiệp, lâm nghiệp và động vật. ƒ Bản đồ liên kết gen cung cấp thông tin vị trí tương đối của các gen các tính trạng theo các nhiễm sắc thể của một loài. Bơiû vì có rất ít thông tin về các gen cụ thể hay các tính trạng mà có thể xác định trực tiếp từ một cây cá thể, chúng ta sử dụng đánh dấu phân tử DNA như các bảng dẫn đường cùng với bản đồ gen. ƒ Bản đồ được phát triển bằng cách xét nghiệm một số DNA marker có liên quan mật thiết của các cá thể. Mỗi marker xác định một vị trí trên bản đồ gọi là một locus. ƒ Nhiều bản đồ liên kết cho một loài cây kinh tế được phát triển để xác định vị trí tính trạng số lượng (QLT loci) và để cung cấp cơ bản cho việc giúp đở chọn lựa các marker. ƒ Việc đánh dấu tính trạng có tính thương mại cần phải trải qua vài năm, chọn lọc đầu tiên là dùng các đánh dấu phân tử để cung cấp thay thế tính trạng hấp dẫn hơn cho cây lai tạo. Bảûn đồà liên kê áát (Linkage Maps) Các gen thích hợp (Candidate Genes) ƒ Người ta thường biệt lập một số gen mà ảnh hưởng đến các tính trạng nào đó của cây như sự ra hoa, phát triển sợi gỗ. Người ta xây dựng bản đồ các gen này và xác định các gen thích hợp mà cùng vị trí với QLT cho các tính trạng thương mại quan trọng. Lên bản đồ gen thích hợp giúp chúng ta hiễu vai trò của một gen trong việc xác định của một tính trạng và trong cải thiện hiệu qủa của việc lai tạo các tính trạng ƒ Với Eucalyptus globulus người ta đã xây dựng được bản đồ cho 4 loại bạch đàn tương đồng của gen thực vật Arabidopsis , 4 gen này đóng vai trò trong việc tổng hợp vách tế bào và 6 gen trong con đường tổng hợp sinh của monolignol. Candidate Genes Locus Full name 4CL 4-Coumarate:Coenzyme A ligase AGE1 Agamous homologue 1 AGE2 Agamous homologue 2 CCoAOMT Caffeoyl Coenzyme A O-methyltransferase CCR Cinnamoyl Coenzyme A reductase COMT Caffeate O-methyltransferase EAP1 Squamosa homologue ECA1 Cellulase homologue ECS1 Cellulose synthase homologue ELF1 Leafy homologue EXS1 Xylan synthase homologue 1 EXS2 Xylan synthase homologue 2 S-adenosyl-homocysteine hydrolaseMsaS2 PAL Phenylalanine ammonia-lyase Name Primer sequences (5' - 3') Repeat motif(s) Dinucleotide microsatellites Am008 CCACCCGTTACCCATTTATGCCGTGATTGACTCTCAGCG (TG)14 Am012 TGAGTCGATCGCTTAGCTTGTCCCGTTATTATGCCAAAGTG (TC)15(AC)7-(AC)10AG Am014 GTACTAACGTTGCTATATGAGAAAGGCTGGTTGTTCGCTTATATGG (ATAC)3(AC)26(AT)3,(GTAT)2 (AT)3AC Am018 CACGGCTGTTATTTCCTTCGGGAAAGAGGTGTGACAGAGGAC (AC)14 Am030 GAGGTAATATTTTGAATTCCTTGAACGGTGTATACCTCTTTCCTGTGG (AT)9(GT)15 Am041 TAGGCTAATGGTCATATTCCTAGAGAGATAGGGGTACACACTAAAAAAC (GT)36 Am136 CCCATTGCCGTTTCTTTGGCATTTCCCTTGGAACAGTC (CT)20 Am164 ACCCGGACGTATAGAAATAAATACACGTGGAGGCAAGCAATATC (TG)93 Am173 TTGGATGTCAAGATTTTACGGCATTAGGCCACGTTTTGATAG (AC)18 Am326 GGACCAAACTTATGCAACACCGCATCAATGTACTAAACCATTTCC (CA)20 Am341 CCATTCGAGCATCCTAAGAGCGTATGGCTGAGCTACTTAATCA (CA)12(TA)2 Am352 CCTCATGTCCTTGAATGTCACGACTAACCCACAAGGAAGAGTTAC (TTC)2TA(AC)14 Am367 CGCAACTCCATCTGATTTACTGTTATGTTGGGTTAATACGCTAACTG (A)7G(A)6GG(A)14,(CA)14 CACAAGGAACTGAGCAATGG Primer sequences of 33 A. mangium microsatellite loci Microsatellites ƒ Microsatellites, hay Simple Sequence Repeats (SSRs), gồm nhiều cặp lập lại từ 1 – 5 cặp motif ƒ Đa hình chiều dài trong chuỗi thường xuất hiện thông qua polymerase trượt trong suốt quá trình lập lại của DNA, gia tăng hoặc giảm số lượng lặp motif bằng một đơn vị tổng quát. ƒ Microsatellites có chất lượng quan trọng mà chúng tạo nên các phân tử đánh dấu mong muốn. ƒ Microsatellite markers thì biến động cao hơn các marker khác. ƒ Tất cả các alleles trong một cá thể có thể thấy được mà không phải trường hợp cho các marker trội như trong RAPD. ƒ Microsatellites rất linh hoạt trong ứng dụng nó có thể sử dụng để phát hiện các khác biệt và biến đổi di truyền trong các quần thể, xác định sự lai tạo giữa các loài, kiểu thụ phấn và phát tán hạt giống, cho phép phân tích nguồn gốc cha và đánh giá lịch sử di truyền vừa qua như quần thể cổ chai. ƒ Người ta dùng microsatellites đánh dấu các cá thể và loài để xây dựng bản đồ gen cho phân tích QTL và hỗ trợ đánh dấu chọn lọc. Theo Daniel Plat, 2004 Details of dinucleotide microsatellite loci characterised from Eucalyptus nitens, E. globulus and E. sieberi Locus Repeat motif Primers (5' - 3') Size En6 (GA)15 GAG CTG GAA ATG GAG CAG AC TCA ATT TTT GCC TCT CCC C 102 En10 (GA)10 ATC AAA TGG CTT TAG CTT TGT G CCC AGA GAC AAA CCG CTC 135 En11 (GA)19A26 GAA CGC CCA CCA CAA AAG AG CTG AAT TCC TCC GAG CTC C 78 En12 (GA)15 CAG AAC CCA GCG GAG GA GGA AAC GCC AAT GTA GCT CT 220 En13 (GA)17 GCC AAA TTG ATG GTA GGC AT CCA GCA AAT TCA AAT TCA CA 96 En14 (GA)18 CCC AAG AAA TCA CCG AAA AC GCT GAC GGA GGA GGA GAT GT 153 En15 (GA)19 TCC TCG TGC TCA TAC TCA AA ATG GCT GGA AGT AAC CGA GA 96 En16 (CAGA)3 (GA)35 TTT CCT CTT CAC GCA CTC G CTC CCG GGC CCT GTA 140 Eg24 (CT)10 CGA CGT CAC AGT TAT GTG GG CCT GAG CTT TTG AAT ACG GG 169 Es054 (CA)13 GGAAGAAATCAAACTGGACACC TTTGCGACTACCATTTTCACC 104 Es076 (TC)19(AC)4 AT(AC)15 AATGCTGCTGTAGACGATGC AAGACAAATCAAGCAAGTCAGC 157 Es115 (ACAT)8(AC)19 (AT)6 ACAATGAAGGATGCAAGAAGC TATGGCTAACTTTTAGCTGGAACA 151 Es140 (GT)20(GA)10 GCTCATTGTACTGCACAGAGG AAGGCACCAACAGTACCTGG 151 Es157 (CT)16 ACCATCACGGCTTCGGAC GGCATTATCGACCGAGGAAC 112 Es211 (GA)17 GGGAGAGCTGATTGAGTAATTG GCTGAGAATGGAAGCACATC 100 Es255 (GT)12 TTTGCCATAGCGAAGTGTTG GACCACTTACCAAACTCACCG 98 Es266 (CT)18 AAATGAAGGGCCTCTTGAAAG CGACGAGCCTACCTAATAAATTG 118 Isozymes ƒ Điện di Isozyme là một kỹ thuật trong phòng thí nghiệm cho việc đánh giá biến động protein trong thực và động vật ƒ DNA khác nhau giữa các cây cá thể, trong các gen mà mã hoá cho enzyme proteins dẫn đến biến đổi trong một chuỗi amino acid và biến đổi trong thay đổi nhiệm vụ của phân tử protein ƒ Một điện trường được dùng để tạo các protein di trú thông qua một gel và nạp điện khác nhau như là kết quả thay đổi khác nhau. Vì vậy biến đổi gen được thấy các băng như “chậm” hay “nhanh” trên gel. ƒ Tần số băng xuất hiện được dùùng để mô tả cây cá thể hoặc quần thể thực vật và có thể dùng để nghiên cứu các mối quan hệ trong phân loại, đa dạng loài và các hệ thống lai tạo hoặc giám sát các chương trình cải thiện giống cây ƒ Kỹ thuật được dùng như là một phương pháp đơn giản, rẽ cho việc đánh giá nhanh nhưng đang được thay thế những kỹ thuật mạnh hơn để để đánh giá biến đổi trực tiếp của DNA. Theo Daniel Plat, 2004 Theo Daniel Plat, 2004 Theo Daniel Plat, 2004 Theo Daniel Plat, 2004 Theo Daniel Plat, 2004 Theo Daniel Plat, 2004 Theo Daniel Plat, 2004
Tài liệu liên quan