Down regulation of zinc finger protein 280D (ZFP-280D)

Abstract. This study demonstrated that high transcript expression levels of ZFP-280D in melanocytes and in benign tumors of 304 Ret mice, a transgenic mouse line in which a systemic skin melanosis, benign melanocytic tumors and malignant melanoma which develop stepwise were inhibited in melanoma cell lines (human and murine) and in the malignant melanoma of 304 Ret mice. The obtained result also showed an overexpression of the ZFP-280 gene which caused a reduction of metastictic ability of SKMEL28 cells in vivo. Although the molecular mechanism underlying the formation and progressions of melanoma remain unresolved, our results might contribute important information to the future discovery of new biomarkers and effective therapies for skin cancer treatment.

pdf7 trang | Chia sẻ: thanhle95 | Lượt xem: 753 | Lượt tải: 0Freedownload
Bạn đang xem nội dung tài liệu Down regulation of zinc finger protein 280D (ZFP-280D), để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
JOURNAL OF SCIENCE OF HNUE DOI: 10.18173/2354-1059.2015-00089 Chemical and Biological Sci. 2015, Vol. 60, No. 9, pp. 134-140 This paper is available online at Received December 20, 2015. Accepted December 30, 2015 Contact Nguyen Dinh Thang, e-mail address: [email protected] 134 DOWN REGULATION OF ZINC FINGER PROTEIN 280D (ZFP-280D) Nguyen Dinh Thang1 and Ichiro Yajima2 1 Faculty of Biology, University of Science, Vietnam National University, Hanoi 2 Occupational and Environmental Health, School of Medicine, Nagoya University, Japan Abstract. This study demonstrated that high transcript expression levels of ZFP-280D in melanocytes and in benign tumors of 304 Ret mice, a transgenic mouse line in which a systemic skin melanosis, benign melanocytic tumors and malignant melanoma which develop stepwise w re inhibited in melanoma cell lines (human and murine) and in the malignant melanoma of 304 Ret mice. The obtained result also showed an overexpression of the ZFP-280 gene which caused a reduction of metastictic ability of SKMEL28 cells in vivo. Although the molecular mechanism underlying the formation and progressions of melanoma remain unresolved, our results might contribute important information to the future discovery of new biomarkers and effective therapies for skin cancer treatment. Keywords: Zinc finger protein 280D, melanocyte, SKMEL28, melanoma, cancer. 1. Introduction While malignant melanoma accounts for less than 5% of all skin cancers, it is responsible for 80% of skin cancer deaths [1]. The outlook for patients with metastatic melanoma remains quite bleak, with a 5-year survived rate of only 5-15%, and that has not changed significantly in recent decades despite intensive efforts to develop an effective therapy. Since melanoma is an aggressive cancer with high metastatic ability, the increase in incidence is a threat to public health. Itis therefore important to find new biomarkers and effective therapies. The c-RET proto-oncogene encodes a receptor-tyrosine kinase, and glial cell line-derived neurotrophic factor (GDNF)-related ligands, including GDNF, neurturin, artemin and persephin, have been reported to be ligands of RET [2]. RFP-RET is a hybrid oncogene between c-RET and RFP, and its kinase activity is highly up-regulated compared with the activity of c-RET tyrosine kinase [3]. Previously, a metallothionein-I/RFP-RET transgenic mouse of line 304/B6 (RET-mice) was established [5] in which systemic skin melanosis, benign melanocytic tumor(s) and malignant melanoma develop stepwise [5]. This transgenic mouse line is a powerful tool for analyzing the effects of molecules on melanomagenesis. Down regulation of zinc finger protein 280D (ZFP-280D) 135 Zinc finger protein 280D (ZFP-280D), a member of the zinc finger protein (Zfp) family, has small DNA recognition motifs which are composed of about 30 amino acid residues and a zinc ion [6]. Snails and Znf652 in the Zfp family have been reported to promo tumorigenesis by regulation of E-cadherin and CBFA2T3 protein, respectively [7, 8]. On the other hand, WT1 in the Zfp family works as a tumor suppressor [9]. And, murine and human Zfp28/ZFP28 transcript expression levels in several organs have been reported [10, 11]. Thus, some Zfp family members are involved in tumor pathogenesis. However, there have been no reports on transcript expression levels of ZFP-280D/ZFP-280D in any organ or the skin in mice or humans, and there have been no reports on ZFP-280D transcript expression levels in any kinds of cancer cells, including melanoma. Moreover, there is no information on its protein expression levels because no antibodies have been available. In this study, we demonstrated for the first time the interaction between ZFP-280D and tumorigenesis. We examined ZFP-280D/ZFP-280D transcript expression levels in various sizes at the benign tumor stage and the malignant stage in 304 RET mice as well as in murine and human cancer cell lines by quantitative PCR (Q-PCR). 2. Content 2.1. Materials and methods * Cell culture All cell lines were cultured in RPMI supplemented with penicillin (400 U/ml), streptomycin (50 mg/ml), L-glutamine (300 mg/L) and 10% fetal bovine serum (FBS; Sigma, Deisenhofen, Germany) under a humidified atmosphere of 5% CO2 at 37 oC. After incubation for 48 hrs, cells were washed with PBS 2 times and lysated by a lysis buffer. Protein was collected and sonicated for 10 mins before being centrifuged at 15,000 rpm at 4 oC for 15 minutes. The obtained supernatant was kept at -20 oC. The protein concentration was measured using a BCA kit. * RNA isolation and reverse transcription Total cellular RNA was isolated from cultured cells using the RNeasy kit (QIAGEN, Hilden, Germany). Reverse transcriptase reaction was performed in a 20 µL reaction volume containing 2 µg of t tal cellular RNA, 4 µL of 5 first-strand buffer (Invitrogen), 2 µL of 0.1 M DTT, 1 µL of dN6-primer (10 mM), 1 µL of dNTPs (10 mM) and DEPC water. The reaction mixture was incubated for 10 min at 70 oC, 200 U of Superscript II reverse transcriptase (Invitrogen) were added, and RNAs were transcribed for 1 h at 37 oC. Reverse transcriptase was inactivated at 70 oC for 10 min and the RNA was degraded by digestion with 1 mL RNaseA (10 mg/mL) at 37 oC for 30 min. * Expression analysis RT-PCR analysis of ZFP-280D was performed using specific primers. The PCR reaction was performed in a 50 µL reaction volume containing 5 µL of 10 Taq-buffer, 2 µL of cDNA, 1 µL of each primer (20 µM), 0.5 µL of dNTPs (10 µM), 0.5 U of Taq polymerase and 41 µL of water. The amplification reactions were performed at 35 cycles for 1 min at 94 oC, 1 min at 62 oC, with a final extension step at 72 oC for 1.5 min. The expression of ZFP-280D was then analyzed. (Primer sequences were obtained from Clontech, BD Biosciences, Heidelberg, German). * Analysis for metastasis in vivo Analysis for metastasis in vivo was performed using a method previously reported [11]. A clone of ZFP-280D-overexpressed SKMEL28 cells (5 × 106; n = 5) a d control SKMEL28 cells (5 × 106; n = 5) in a 50 µL serum-free RPMI medium were injected into the tail vein of Nguyen Dinh Thang and Ichiro Yajima 136 6-8-week old C57/BL6 mice, and metastatic foci in the lungs on the 14th day after inoculation were evaluated by counting under a microscope. 2.2. Results and discussions 2.2.1. High transcript expression of ZFP-280D in immortalized melanocyte (melan-a) and in keratinocyte (NIH3T3) decreased in murine melanoma cell lines and in other murine cancer cell lines. In this study, we characterized for the first time the expression of ZFP-280D in mouse immortalized melanocyte melan-a ( e 1) and keratinocyte NIH3T3 (lane 2) as well as in murine melanoma cell lines including B16, B16F10, B16BL6, MELRET9 and MEL25 (lanes: 3 - 7, respectively) and in other mouse cancer cell lines, including Clone m3, MN102, colon26, P815, MH129 and Raw (lanes: 8 - 13, respectively). Interestingly, ZFP-280D transcript expression in melan-a and in NIH3T3 was higher than that in melanoma cell lines and in other cancer cell lines. It showed that the ZFP-280D transcript expression in melan-a was 1.56 - 2.56 times and 1.72 - 5.0 times higher than that in murine melanoma cell lines and other mouse cancer cell lines, respectively (Figure1). Similarly, ZFP-280D transcript expression in NIH3T3 was 1.92 - 3.15 and 2.12 - 6.15 higher than that in murine melanoma cell lines and other mouse cancer cell lines, respectively (Figure 1). Our results suggest that ZFP-280D might be correlated with pathogenesis of melanoma. Figure 1. ZFP-2 and TATGTCCCCCGTTGACTGAT for Hprt. Lanes: 1-melane-a, 2-NIH3T3, 3-B16, 4-B16F10, 5-B16BL6, 6-MELRET9, 7-MEL25, 8-CLONE m3, 9-MN102, 10-COLON26, 11-P815, 12-MH129 and 13-RAW Representative results of three independent experiments with consistent results are shown *, ** were significantly different (P <0.05 and P < 0.01) from the control, respectively 80D transcript expression levels in mouse cell lines. ZFP-280D transcript expression levels in mouse cells were examined looking at the quantitative polymerase chain reaction (Q-PCR) using the primers TCCATTTTCTCCTTGCATGTC and CCCGTTTTGCCTCAAAGTTA for ZFP-280D and the primers CTTTGCTGACCTGCTGGATT. ** ** ** ** ** ** ** ** * ** ** 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1 2 3 4 5 6 7 8 9 10 11 12 13 C o n tro l fo ld in g Down regulation of zinc finger protein 280D (ZFP-280D) 137 2.2.2. High transcript expression of ZFP-280D in benign tumors decreased in malignant melanomas in RET-mice. We next investigated transcript expression levels of ZFP-280D at both the benign and malignant melanoma stage in 304-Ret mice, a transgenic mouse line in which a systemic skin melanosis, benign melanocytic tumor and malignant melanoma develop stepwise [4]. A B Figure 2. ZFP-280D transcript expression levels in benign and malignant tumors of various sizes from RET-mice. A-Transcript expression level of ZFP-280D in benign tumor and malignant of 304 RET mice, B-Transcript expression level of ZFP-280D in various malignant sizes of 304 RET mice Representative results of three independent experiments with consistent results are shown. *, ** were significantly different (P < 0.05) and (P < 0.01) from the control, respectively ZFP-280D transcript expression levels were examined usinf Q-PCR with primers TCCATTTTCTCCTTGCATGTC and CCCGTTTTGCCTCAAAGTTA for ZFP-280D and primers CTTTGCTGACCTGCTGGATT and TATGTCCCCCGTTGACTGAT for Hprt. Differences were statistically analyzed using the Mann–Whitney U-test. As it was found in previous studies that grade malignancy progress in terms of tumor growth in RET-mice [4, 5], ZFP-280D transcript expression levels might decrease with the progression of malignancy grade in melanocytic tumors in RET-mice. According to a previous report (4), in this study, RET-mice developed benign melanocytic tumors at the age of 7 months at a rate of 100% (n = 6), and melanoma at the age of 18 months at a rate of 83% (n = 6). All mice were sacrificed to obtain the benign tumor and malignant melanoma in order to check ZFP-280D transcript expression levels by Q-PCR. In fact, we confirmed that the levels of ZFP-280D transcript in melanoma were significantly lower than those in benign tumors in RET-mice (Figure 2A). Although it is not clear at present whether it works as a ** * * ** 0.0 0.2 0.4 0.6 0.8 1.0 1.2 S200 S315 S720 S13750 S20000 S30000 S67500 Benign tumors Malignant 0.0 0.2 0.4 0.6 0.8 1.0 1.2 Benign Malignant ** Nguyen Dinh Thang and Ichiro Yajima 138 tumor promoter or suppressor, our results suggest that ZFP-280D can be correlated with melanomagenesis. We further examined ZFP-280D transcript expression levels with various sized tumors at the benign stage as well as at the malignant melanoma stage from RET-mice. The significant difference of transcript ZFP-280D expressions in malignant tumor sizes is shown in figure 2B. The bigger the malignant tumor size, the lower the xpression of ZFP- 280D, while in the benign tumor stage there was no significant difference of ZFP-280D transcript expressions that depend on tumor sizes. In agreement with the results of expression levels of ZFP-280D in benign and malignant stages of m lanoma, this result points out that ZFP-280D may play an important role in melanoma tumor suppression. 2.2.3. High transcript expression of ZFP-280D in primary human melanocytes (NHEMs) decreased in human melanoma cell lines and in other human cancer cell lines. Figure 3. ZFP-280D transcript expression levels in human cells. Lanes: 1-NHEM, 2-G361, 3-SKMEL28, 4-A375M, 5-MNT1, 6-TGW, 7-HSC5, 8-NALM, 9-THP1, 10-HT1080, 11-RAJI and 12-HepG2 Representative results of three independent experiments with consistent results are shown. *, ** were significantly different (P < 0.05) and (P < 0.01) from the control, respectively ZFP-280D transcript expression levels in human cells were examined by quantitative polymerase chain reaction (Q-PCR) using the primers TCCATTTTCTCCTTGCATGTC and CCCGTTTTGCCTCAAAGTTA for ZFP-280D and the primers CACGAACCACGGCACTGATT and TTTTCTTGCTGCCAGTCTGGAC for TBP. For further confirmation we investigated of ZFP-280D transcript expression levels of ZFP-280D in the human melanocyte NHEM (lane 1) and in melanoma cell lines (Figure 3) of G361, SKMEL28, MNT1 and A375M (lanes 2 - 5, respectively) and other human cancer cell lines, including lymphomas: Raji, NALM, monocytic leukemia: THP-1, neuroblastoma: TGW, skin squamous cell arcinomas: HSC-5, fibrosarcoma: HT1080, hepatoma: HepG2 (lanes 6 - 12, respectively). ZFP-280D expression level in human melanocytes is 1.60 - 4.56 times and 1.4 - 10 times higher than that in human melanoma and in other human cancer cell lines, respectively (Figure 3). Our results suggest that murine ZFP-280D transcript levels highly expressed in melanocytes were inhibited in melanomas. 2.2.4. Over-expression of ZFP-280D resulted in decreasing invasion ability of SKMEL28 cells both in vitro and in vivo. We then carried out the cloning experiments to get SKMEL28 clones with a overexpression of ZFP-280D to investigate the role of protein ZFP-280D in vivo. Control clones and ZFP-280D-overexpressed clones w re injected into the tail veins of the C57/BL6 0.0 0.2 0.4 0.6 0.8 1.0 1.2 Down regulation of zinc finger protein 280D (ZFP-280D) 139 mice. After 14 days, mice were sarcrified to discover the metastatic ability of SKMEL28 cells. Our results showed that an over-expr ssion of ZFP-280D strongly inhibited the number of colonies formed in the lung of the C57/BL6 mice compared to that of the control mice (Figure 4A-B). The number of colonies in the lungs of the ZFP-280D mice was about 5 times less than that in the control mice (Figur 4-C). This result suggests that ZFP-280D may act as a tumor suppressor and can be used as a novel target when treating metastic melanoma. Figure 4. Relationship between ZFP-280D expression levels and metastatic characteristics of cancer cells. Colonies formed in the lungs of control C57/BL6 mice injected with control SKMEL28 cells (A), colonies formed in the lung of treated C57/BL6 mice injected with ZFP-280D-overexpressed-SKMEL28 cells (B), ratio of number of colonies in the lungs of control mice to that of ZFP-280D mice (C) ** is significantly different (P < 0.01) from the control 3. Conclusion In this study, we revealed that the transcription level of ZFP-280D was highly expressed in normal cells such as NHEMs of humans and melan-1 and NIH3T3 of mice but was downregulated in the human and mouse melanoma cell lines. The obtained results also show that while there was high expression of theZFP-280D gene inbenign tumors, it was inhibited in the malignant tumors of RET-transgenic mice. More importantly, overexpression of ZFP-280D in SKMEL28 cells caused a reduction of invasive ability of this cell line in vivo, proven by the decreased number of colonies in the lungs of C57/BL6 mice. Although the mechanism is not clear, our results suggest that murine and human zinc finger protein 280D (ZFP-280D) can be correlated with the pathogenesis of melanoma as a tumor suppressor. Therefore, ZFP-280D might be considered to be both a bi marker and a novel target for melanoma treatment. Acknowledgments: This research is funded by the Vietnam National Foundation for Science and Technology Development (NAFOSTED) under grant number 106-NN.02-2013.07. Nguyen Dinh Thang and Ichiro Yajima 140 REFERENCES [1] Tsao H., Atkins M. B., Sober A. J., 2004. Management of cutaneous melanoma. N Engl J Med Vol. 351, pp. 989-1012. [2] Takahashi M., 2001. The GDNF/RET signaling pathway and human diseases. Cytokine Growth Factor Rev. 12, pp. 361-373. [3] Kato M., Iwashita T., Akhand A. A, Liu W., Takeda K., Taheuchi K., t al., 2000, Molecular mechanism of activation and superactivation of Ret tyrosine kinases by ultraviolet light irradiation. Antioxid Redox Signal 2, pp. 841-849. [4] Kato M., Takahashi M., Akhand A. A., Liu W., Dai Y., Shimizu S., et al., 1998, Transgenic mouse model for skin malignant melanoma. Oncogene 17, pp.1885-1888. [5] Kato M., Takeda K., Kawamoto Y., Tsuzuki T., Hossain K., et al., 2004. C-Kit targeting immunotherapy for hereditary melanoma in a mouse model. Cancer Res 64, pp. 801-896. [6] Mackay J. P., Crossley M., 1998. Zinc fingers are sticking together. Trends Biochem Sci., 23, pp. 1-4. [7] E. Battle, E. Sancho, C. Franci, D. Dominguez, M. Monfar, J. Baulida, et al., 2000. The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat. Cell Biol, 2, pp. 84-89. [8] Kumar R., Manning J., Spendlove H. E., Kremmidiotis G., McKirdy R., Lee J., et al., 2006. Callen DF ZNF652, a novel zinc finger protein, interacts with the putative breast tumor suppressor CBFA2T3 to repress transcription. Mol Cancer Res 4, pp.655-665. [9] Morrison A. A., Viney R. L., Ladomery M. R., 2008 The post-transcriptional roles of WT1, a multifunctional zinc-finger protein. Biochim Biophys Acta 1785, pp. 55-62. [10] Chowdhury K., Rohdewohld H., Gruss P., 1998. Specific and ubiquitous expression of different Zn finger protein genes in themouse. Nucleic Acids Res 16, pp. 9995-10011. [11] Zhou L., Zhu C., Luo K., Li Y., Pi H., Yuan W., et al., 2002. Identification and characterization of two novel zinc finger genes, ZNF359 and ZFP28, in human development. Biochem Biophys Res Commun, Vol. 295, pp. 862-868.